Write a brief outline of the mechanisms in which DNA is used to generate protein.

Write a brief outline of the mechanisms in which DNA is used to generate protein. You
do not need to provide a fine level of detail, but ensure you reflect
on the key points in the process and mention any major differences
between the mechanism in prokaryotic and eukaryotic cells
Although the DNA in our genes is considered to be the heritable
genetic material, other factors, including the environment are
considered to play an important role in the activity and expression of
those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
Finally – using the codon table found in Figure 15.4 in
Chapter 15 of the textbook, translate these two almost identical RNA
strands into peptide sequences, using the first base of each as the
first triplet in a codon. You will notice that the second
strand has a point deletion (the u in bold) with respect to the first
strand – comment on how this has affected the resulting peptide chain.

aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

Link to Codon Table:
https://openstax.org/books/biology-2e/pages/15-1-the-genetic-code

Last Completed Projects